|
|
|
| Authors: | M. Okuda, S. Takeuchi, S. Taba, K. Kato, K. Hanada |
Abstract:
Melon yellow spot virus (MYSV) and Watermelon silver mottle virus (WSMoV) are distinct virus species belonging to the genus Tospovirus in the Family Bunyaviridae. They have quasi-spherical virions with lipid envelopes where three single-stranded RNA segments are contained, and are persistently transmitted by Thrips palmi. WSMoV was first identified in 1982, and it has been causing problems on watermelon, wax gourd, melon, cucumber and bitter gourd productions in Japan and Taiwan.
MYSV was first identified in 1992, and it has been causing severe damages on melon and cucumber productions in Japan.
Nucleotide sequences of the smallest RNA segments of WSMoV and MYSV were analyzed to examine genetic relationships.
Identities of the nucleocapsid protein genes of WSMoV or MYSV with other tospovirus species suggested that MYSV and Physalis severe mottle virus (PYSV) were considerably similar.
Identities of the nucleocapsid protein genes and the non-structural genes of two isolates of MYSV from cucumber plants with those of reported MYSV with those with PSMV were more than 96%. Therefore, PSMV and MYSV should be classified as the same species.
Comparison of Japanese isolates and Taiwanese isolates of WSMoV suggested that they are genetically related each other, except for a 20 nucleotide insertion sequence was found in Japanese isolates.
RT-PCR assay with specific primers of WSMoV or MYSV were examined.
RT-PCR with WSMoV specific primers WN5 (5' -GCACACACATAGGTATAACT-3') and WN3
(5' -TCCTTTGTAAACACCATG-3') detected approximately 1.1 kb DNA fragment from WSMoV-infected samples.
RT-PCR with MYSV specific primers MN5
(5' TATTTCATTCAACTAGTTAA3') and MN3 (5' ATTCAACATCAGCAAGTCAA3') detected approximately 1.0 kb DNA fragment only from MYSV-infected samples.
No significant amplification was detected from other tospovirus -infected samples or healthy samples.
|
Download Adobe Acrobat Reader (free software to read PDF files) |
|